π¬ What is DNA?
DNA (Deoxyribonucleic Acid) is like a recipe book for life. It contains all the instructions needed to build and maintain an organism. Think of it as a very long instruction manual written in a 4-letter alphabet: A (Adenine), T (Thymine), G (Guanine), and C (Cytosine).
The order of these letters determines everything from your eye color to how your body fights diseases!
π Sequence Overview
π Size Comparison
This DNA sequence is 950 base pairs long. That's about the length of a typical gene - small enough to read quickly!
π‘ Did You Know?
If you printed this DNA sequence with 60 letters per line, it would take 16 lines of text!
DNA is incredibly tiny: A single human cell contains about 2 meters of DNA, but it's packed so tightly that you'd need a microscope to see it. If you unraveled all the DNA in your body, it would stretch to the Sun and back over 300 times!
GC Content matters: The 47.8% GC content in this sequence tells us about its stability. Higher GC content (like this would have) means stronger bonds and more heat resistance!
π Composition Analysis
This pie chart shows the balance between GC pairs (strong bonds) and AT pairs (weak bonds) in the DNA
𧬠DNA Sequence (Color-Coded)
GATCGTACGATCGTAGCTAGCTACGATCGATCGTAGCTAGCT
Total nucleotides: 42
A: 10 | T: 11 | G: 11 | C: 10
π€ What Does This All Mean?
For Scientists: This DNA sequence can be used to identify genes, study mutations, or compare with other organisms.
For Everyone Else: Think of this as a tiny piece of the instruction manual that makes Gallus gallus unique. Scientists can "read" these instructions to understand how life works!
The 47.8% GC content tells us this DNA has a balanced composition - typical of many common genes!