π¬ What is DNA?
DNA (Deoxyribonucleic Acid) is like a recipe book for life. It contains all the instructions needed to build and maintain an organism. Think of it as a very long instruction manual written in a 4-letter alphabet: A (Adenine), T (Thymine), G (Guanine), and C (Cytosine).
The order of these letters determines everything from your eye color to how your body fights diseases!
π Sequence Overview
π Size Comparison
This DNA sequence is 1,350 base pairs long. That's roughly the size of a bacterial gene cluster - imagine a paragraph in a book.
π‘ Did You Know?
If you printed this DNA sequence with 60 letters per line, it would take 22 lines of text!
DNA is incredibly tiny: A single human cell contains about 2 meters of DNA, but it's packed so tightly that you'd need a microscope to see it. If you unraveled all the DNA in your body, it would stretch to the Sun and back over 300 times!
GC Content matters: The 46.7% GC content in this sequence tells us about its stability. Higher GC content (like this would have) means stronger bonds and more heat resistance!
π Composition Analysis
This pie chart shows the balance between GC pairs (strong bonds) and AT pairs (weak bonds) in the DNA
𧬠DNA Sequence (Color-Coded)
ACGATCGATCGTACGATCGTAGCTAGCTACGATCGATCGTAG
Total nucleotides: 42
A: 11 | T: 10 | G: 11 | C: 10
π€ What Does This All Mean?
For Scientists: This DNA sequence can be used to identify genes, study mutations, or compare with other organisms.
For Everyone Else: Think of this as a tiny piece of the instruction manual that makes Rattus norvegicus unique. Scientists can "read" these instructions to understand how life works!
The 46.7% GC content tells us this DNA has a balanced composition - typical of many common genes!